View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8233_high_25 (Length: 209)
Name: NF8233_high_25
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8233_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 25 - 200
Target Start/End: Complemental strand, 54277342 - 54277167
Alignment:
| Q |
25 |
aatgcatagtccattagacccccattgcaaccattgttgtaagttgtgtcacagtcgattaattcttgctcggacaaagatgtcaaattccctgtcacaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277342 |
aatgcatagtccattagacccccattgcaaccattgttgtaagttgtgtcacagtcgattaattcttgctcggacaaagatgtcaaattccctgtcacaa |
54277243 |
T |
|
| Q |
125 |
tttggtttattccttcaaccgcagcaacagtcgaaaatgcccagcaactacctgcaagtactcgtgttcatctcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54277242 |
tttggtttattccttcaaccgcagcaacagtcgaaaatgcccagcaactacctgcaagtactcgtgttcatatcac |
54277167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University