View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8233_low_16 (Length: 336)
Name: NF8233_low_16
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8233_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 20 - 326
Target Start/End: Complemental strand, 11402633 - 11402327
Alignment:
| Q |
20 |
ggattttcataagactcacaattgttttgatctaaattttctgcaatctgtgcatgatgtttatatcttcaatcgtctgctttgcgctcaaacttttcgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402633 |
ggattttcataagactcacaattgttttgatataaattttttgcaatctgtgcatgatgtttatatcttcaatcgtctgctttgcgctcaaacttttcgc |
11402534 |
T |
 |
| Q |
120 |
ggtgaaaacataatttctcctctcttggttgtaataacttcttcctttgccatatatagttgatagaaccaaaattgtttccaccttttggattgaaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402533 |
ggtgaaaacataatttctcctctcttggttgtaataacttcttcctttgccatatataattgatagaaccaaaattgtttccaccttttggattgaaatt |
11402434 |
T |
 |
| Q |
220 |
gttctctcttttgatcgaagtttccatgtcctctcccatttgattggattcattaatattattgaagttcacttgacttttcaaggcttcctcctttgct |
319 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402433 |
gttctctcttttgatcgaagttttcatgtcctctcccatttgattggattcattaatgttattgaagttcacttgacttttcaaggcttcctcctttgct |
11402334 |
T |
 |
| Q |
320 |
ttctctg |
326 |
Q |
| |
|
||||||| |
|
|
| T |
11402333 |
ttctctg |
11402327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University