View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8233_low_22 (Length: 255)

Name: NF8233_low_22
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8233_low_22
NF8233_low_22
[»] chr4 (1 HSPs)
chr4 (1-241)||(48447790-48448024)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 48448024 - 48447790
Alignment:
1 tcagtggttggtgggaccggttttcgtttggagcgaggaggcatcttcttcgtatgaagaatggtgaaatcgaagagcgattgagaatgaaatcgaaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48448024 tcagtggttggtgggaccggttttcgtttggagcgaggaggcatcttcttcgtatgaagaatggtgaaatcgaagagcgattgagaatgaaatcgaaaga 48447925  T
101 ccgttgttgaaagaaaagaagaaaccctatttatttatgtgtagagaatggtgatggtgatgtgaagaagaggagggaggagcatcgcgttcaaagattg 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||      ||||||||||||||||||||||||||||||||||||||||||    
48447924 ccgttgttgaaagaaaagaagaaaccctatttatttatttgtagagaatggt------gatgtgaagaagaggagggaggagcatcgcgttcaaagattg 48447831  T
201 gatgaatgaacaaggtttaagtgaggttttatatttccttc 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
48447830 gatgaatgaacaaggtttaagtgaggttttatatttccttc 48447790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University