View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8233_low_25 (Length: 237)
Name: NF8233_low_25
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8233_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 8262547 - 8262343
Alignment:
| Q |
16 |
tgtgcccatttcctatttgttgttgggttgttgaaaaaattaaatgtcactatatttaagactctgcttctctgtctctttattggtccctcccttctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262547 |
tgtgcccatttcctatttgttgttgggttgttgaaaaaattaaatgtcactatatttaagactctgcttctctgtctctttattggtccctcccttctct |
8262448 |
T |
|
| Q |
116 |
catacattaaattttaagaatctcacaggacatcatagttactctagcaaaaaacatgccaccttcttcttcactctattctgttttttcatagggtcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262447 |
catacattaaattttaagaatctcacaggacatcatagttactctagcaaaaaacatgccaccttcttcttcactctattctgttttttcatagggtcac |
8262348 |
T |
|
| Q |
216 |
gttaa |
220 |
Q |
| |
|
||||| |
|
|
| T |
8262347 |
gttaa |
8262343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University