View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8233_low_26 (Length: 228)
Name: NF8233_low_26
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8233_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 70 - 209
Target Start/End: Original strand, 8525685 - 8525824
Alignment:
| Q |
70 |
gaaattgatttgagattaaaggtgctgacatttttgtcgacttgaaaagtgtagattcgagaatcaagagtcttgatattgagatgaagagttgaatctt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8525685 |
gaaattgatttgagattaaaggtgctgacatttttgtcgacttgaaaagtgtagattcgagaatcaagagtcttgatattgagatgaagagttgaatctt |
8525784 |
T |
 |
| Q |
170 |
gttgttcagaaacaatggtgccggtgctggagctgccttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8525785 |
gttgttcagaaacaatggtgccggtgctggagctgccttc |
8525824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 8525634 - 8525668
Alignment:
| Q |
16 |
atgaaataattgattgaaaagagtaatcaatcagt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8525634 |
atgaaataattgattgaaaagagtaatcaatcagt |
8525668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University