View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8233_low_28 (Length: 215)
Name: NF8233_low_28
Description: NF8233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8233_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 14 - 199
Target Start/End: Complemental strand, 932164 - 931981
Alignment:
| Q |
14 |
aagaagggaaaatcataaagctgttgaaaagtttaattggcatagttaactgcgtattaatcagagttaatgtttaattaacataagaaacataactttt |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
932164 |
aagaagggaaaatca---agctgttgaaaagtttaattggcatagttaactgcgtattaatcagagttaatgtttaattaacataagaaacataactttt |
932068 |
T |
|
| Q |
114 |
-nnnnnnnnnnnnnnnncataacttctgtttaagaaacattattgctcattattgttagaggtgtacgagttaaattttcatcaaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
932067 |
aaaaaataaaaaaaaaacataacttctgtttaagaaacattattgctcattattgttagaggtgtacgagttaaattttcatcaaat |
931981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University