View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8234_high_4 (Length: 322)
Name: NF8234_high_4
Description: NF8234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8234_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 44 - 306
Target Start/End: Complemental strand, 43808310 - 43808048
Alignment:
| Q |
44 |
gttattcatgctcatggttggcgttatttggttctgctatatttcttcttattgctgattttccattctgatttgttttagggtgccattatgcacattg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43808310 |
gttattcatgctcatggttggcgttatttggttctgctatatttcttcttattgctgatttttcattctgatttgttttagggtgccattatgcacattg |
43808211 |
T |
 |
| Q |
144 |
ttttgctttgatttttgcttttcatatatgctgaaatatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgact |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43808210 |
ttttgctttgatttttgcttttcatatatgctgaaatatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgact |
43808111 |
T |
 |
| Q |
244 |
gtggaaatgcttgggactgtgttttgatgtttgggtcgactttgtatgagtattgcaagattg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43808110 |
gtggaaatgcttgggactgtgttttgatgtttgggtcgactctgtatgagtattgcaagattg |
43808048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 44 - 144
Target Start/End: Complemental strand, 37147935 - 37147832
Alignment:
| Q |
44 |
gttattcatgctcatggttggcgttatttggttctgctatatttcttcttattgctgattttccattc---tgatttgttttagggtgccattatgcaca |
140 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||| | ||| |||||||||||||||||||||| |
|
|
| T |
37147935 |
gttattcatgctcatggttcatgttatttggttctgctatatttcttcttatttctgattttttattctcttttttttttttagggtgccattatgcaca |
37147836 |
T |
 |
| Q |
141 |
ttgt |
144 |
Q |
| |
|
|||| |
|
|
| T |
37147835 |
ttgt |
37147832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 171 - 306
Target Start/End: Original strand, 38507406 - 38507541
Alignment:
| Q |
171 |
atgctgaaatatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgactgtggaaatgcttgggactgtgttttga |
270 |
Q |
| |
|
||||| |||||||||||||| | || || ||||| ||| ||||||| ||||||||||||||| |||||||| || ||||| |||||||||||||||| |
|
|
| T |
38507406 |
atgctcaaatatgaaggacgcgttcagcaggttattaacatggctgccacaaccgtgaaactggtggatgactatgaaaatgagtgggactgtgttttga |
38507505 |
T |
 |
| Q |
271 |
tgtttgggtcgactttgtatgagtattgcaagattg |
306 |
Q |
| |
|
||||||| | |||| ||||||| | |||||||||| |
|
|
| T |
38507506 |
tgtttggattgactccgtatgagcactgcaagattg |
38507541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 284
Target Start/End: Original strand, 48539555 - 48539613
Alignment:
| Q |
226 |
tgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggtcgact |
284 |
Q |
| |
|
||||| ||| |||||| ||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
48539555 |
tgaaaatggtggatgattgtggaaattgttgggactgtgttttgatctttggctcgact |
48539613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 284
Target Start/End: Complemental strand, 13066257 - 13066199
Alignment:
| Q |
226 |
tgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggtcgact |
284 |
Q |
| |
|
||||| ||| |||||| ||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
13066257 |
tgaaaatggtggatgattgtggaaattgttgggactgtgttttgatctttggctcgact |
13066199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University