View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8234_high_6 (Length: 286)
Name: NF8234_high_6
Description: NF8234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8234_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 261
Target Start/End: Original strand, 12268894 - 12269132
Alignment:
| Q |
23 |
gattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggnnnnnnnnnnccgcatattacgtgtcgtgctaggtgt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12268894 |
gattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggttttttttttccgcatattacgtgtcgtgctaggtgt |
12268993 |
T |
|
| Q |
123 |
ttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgtgaattattatttttgctacgaaaaatgtt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12268994 |
ttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgagaattattatttttgctacgaaaaatgtt |
12269093 |
T |
|
| Q |
223 |
atgaggaatgtattaattgaataatggtattcatacttt |
261 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12269094 |
atgaggattgtattaattgaataatggtattcatacttt |
12269132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University