View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8234_low_15 (Length: 234)
Name: NF8234_low_15
Description: NF8234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8234_low_15 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 33457074 - 33456855
Alignment:
| Q |
15 |
atgaactcttaagaaactaaattagacaactcaaaaagcagtaatatgataannnnnnncagggattattttaataatttatcaattttaataactaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33457074 |
atgaactcttaagaaactaaattagacaactcaaaaagcagtaatatgataatttttttcagggattattttaataatttatcaattttaataactaaat |
33456975 |
T |
 |
| Q |
115 |
tggcataatatatgtgtgcaaaattggcatcttcgttagcatctccattttcacaaacgctcacaaatattgctgatgagggagaaattttagagtctag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456974 |
tggcataatatatgtgtgcaaaattggcatcttcgttagcatctccatttttacaaacgctcacaaatattgctgatgagggagaaattttagagtctag |
33456875 |
T |
 |
| Q |
215 |
catttcaatgttgcaacaat |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33456874 |
catttcaatgttgcaacaat |
33456855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University