View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8234_low_9 (Length: 285)
Name: NF8234_low_9
Description: NF8234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8234_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 84 - 261
Target Start/End: Complemental strand, 1715981 - 1715800
Alignment:
| Q |
84 |
tgaagataaatgatgaaagtgttgcctggaaaaggnnnnnnn----ggacgaattgtgtagttgcctaannnnnnnggcatcacattattagaaccatac |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1715981 |
tgaagataaatgatgaaagtgttgcctggaaaaggaaaaaataaaaggacgaattgtgtagttgcctaatttttttggcatcacattattagaaccatat |
1715882 |
T |
 |
| Q |
180 |
aattggcctgttaatttttctccatcaattttccttaatttttaaatattattactagtacgaatgtatgtggccaagctct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1715881 |
aattggcctgttaatttttctccatcaattttccttaatttttaaatattattactagtacgaatatatgtggccaagctct |
1715800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University