View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8235_high_2 (Length: 315)
Name: NF8235_high_2
Description: NF8235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8235_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 37204067 - 37204357
Alignment:
| Q |
17 |
agatatctccattcctctcaatgctgagattacttgtgtcatgaatgctattgaattggtttttcagaaagattggatggatgcatttatggattgagtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204067 |
agatatctccattcctctcaatgctgagattacttgtgtcatgaatgctattgaattggtttttcagaaagattggatggatgcatttatggattgagtc |
37204166 |
T |
 |
| Q |
117 |
taattcacaactcattgttcaagcatacaagaattatagccgttgggttaatgcatccaacttagatatatgaacttta--ttttttactctttaaagag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37204167 |
taattcacaactcattgttcaagcatacaagaattatagccgttgggttaatgcatccaacttagatatatgaactttattttttttactctttaaagag |
37204266 |
T |
 |
| Q |
215 |
ggcgatcatttgtgctaatttaatggctctgctctaaaagtgcattttaatggtctccattcgtggaatcaagttactgctagtatctctg |
305 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
37204267 |
ggcgatcatttgtgctaacttaatggctctgctctaaaagtgcattttaatggtctgcattggtggaatcaagtcactgctagtatctctg |
37204357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University