View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8236_low_18 (Length: 263)
Name: NF8236_low_18
Description: NF8236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8236_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 55 - 253
Target Start/End: Complemental strand, 43332672 - 43332473
Alignment:
| Q |
55 |
gcacaaaaatgaccaatcagccctattacttccctataaaagaaactctattactactaattttgggcnnnnnnnn-ctttaatcaccatcaacaacact |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43332672 |
gcacaaaaatgaccaatcagccctattacttccctataaaagaaactctattactactaattttgggcaaaaaaaaactttaatcaccatcaacaacact |
43332573 |
T |
|
| Q |
154 |
tccaaaatcctatcaaacatatacgtctaattaactcgaaaccatgatcatgaatccaagcatgaatgtaagttccttactctctatttttgttgttcat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43332572 |
tccaaaatcctatcaaacatatacgtctaattaactcgaaaccatgatcatgaatccaagcatgaatgtaagttccttactctctatttttgttgttcat |
43332473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University