View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8236_low_9 (Length: 409)
Name: NF8236_low_9
Description: NF8236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8236_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 156 - 389
Target Start/End: Original strand, 41127087 - 41127324
Alignment:
| Q |
156 |
catccaaattggaatctcacatgggcatgcccagtttcagtctgttatttgtttatttacgtacatgaccaaactcttactata----tataatatgatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41127087 |
catccaaattggaatctcacatgggcatgcccagtttcagtctgttatttgtttatttacgtacatgaccaaactcttactatatatatataatatgatt |
41127186 |
T |
|
| Q |
252 |
tgattcattctagtacacagcaacgtgtatgttgatttgttacctgacatccccttatgctctatttttaatacatgttcatactagttcaacataacac |
351 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127187 |
tgattcattttagtacacagcaacgtgtatgttgatttgttacctgacatccccttatgctctatttttaatacatgttcatactagttcaacataacac |
41127286 |
T |
|
| Q |
352 |
ctagtttggaagggaagaactcaagatgcttttcctca |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41127287 |
ctagtttggaagggaagaactcaagatgcttctcctca |
41127324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 6 - 74
Target Start/End: Original strand, 41126934 - 41127002
Alignment:
| Q |
6 |
gagatgaatgtaaatttatttgtctggtcctctctgatataagaaacagacgccattatctcaacatac |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41126934 |
gagatgaatgtaaatttatttgtctggtcctctctgatataagaaacagacgccattatctcaacatac |
41127002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University