View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8237_high_4 (Length: 266)
Name: NF8237_high_4
Description: NF8237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8237_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 15901537 - 15901307
Alignment:
| Q |
18 |
agagaataagcaagttaatttgcaaaacaagaaactcactcttgaagagctgaaattgcatcctcaacttccctttgagatggaacagtctcaaatacag |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15901537 |
agagaataagcaagttaattcacaaaacaagaaactcactcttgaagagctgaaattgcatcctcaacttcccttcgagatggaacagtctcaaatacag |
15901438 |
T |
|
| Q |
118 |
gagtatagagactgccacttgatgttatctcctgttttctgcagaactgaccattacagcaacaagaagataaggttttattggcgttattcaattgagg |
217 |
Q |
| |
|
|| |||||||||| ||| ||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15901437 |
gattatagagactaccatttgatgttatctcttgttttctgcagaactggccattacagcaactagaagataaggttttattggcgttactcaattgagg |
15901338 |
T |
|
| Q |
218 |
tacaagatgatcaatatgcatagttccacct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15901337 |
tacaagatgatcaatatgcatagttccacct |
15901307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University