View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8238_low_8 (Length: 250)
Name: NF8238_low_8
Description: NF8238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8238_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 21 - 161
Target Start/End: Original strand, 5383811 - 5383951
Alignment:
| Q |
21 |
caagtcgccgcatatcctaacccctttcagatccctaaccccttttccatcaccttcgcaactcttctccctctcatcatcgtctttgtcgtcgtcgttg |
120 |
Q |
| |
|
|||| ||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5383811 |
caagccgctgcatatcataatccctttcagatccctaaccccttttccatcacctttgcaactcttctccctctcatcatcgtctttgtcgtcgttgttg |
5383910 |
T |
|
| Q |
121 |
tttccggcgaggcaatcgttgccgacgtgtagcacaacaac |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5383911 |
tttccggcgaggcaatcgttgccgacgtgtagcacaacaac |
5383951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 21 - 161
Target Start/End: Complemental strand, 37323928 - 37323788
Alignment:
| Q |
21 |
caagtcgccgcatatcctaacccctttcagatccctaaccccttttccatcaccttcgcaactcttctccctctcatcatcgtctttgtcgtcgtcgttg |
120 |
Q |
| |
|
|||| ||| ||| ||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
37323928 |
caagccgcagcaaatcataaaccctttcagaaccctaaccccttttccatcaccttcgcaactcttctccctctcatcatcgtctatgtcgtcgtagttg |
37323829 |
T |
|
| Q |
121 |
tttccggcgaggcaatcgttgccgacgtgtagcacaacaac |
161 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37323828 |
tttccggcaaggcaatcgttgccaacgtgtagcacaacaac |
37323788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 8372145 - 8372177
Alignment:
| Q |
117 |
gttgtttccggcgaggcaatcgttgccgacgtg |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
8372145 |
gttgtttccggcgaggcaatcgtttccgacgtg |
8372177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University