View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8240_low_6 (Length: 239)
Name: NF8240_low_6
Description: NF8240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8240_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 4172355 - 4172150
Alignment:
| Q |
17 |
tcttaaatctccaacttgtcataccagaattggatctctcagaagttccaaattaatcaaggttcaatcttcagtccaaaaggaacatgttgtcattgtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172355 |
tcttaaatctccaacttgtcataccagaattggatctctcagaagttccaaattaatcaaggttcaatcttcagtccaaaaggaacatgttgtcattgtg |
4172256 |
T |
|
| Q |
117 |
ggtggtggcattgcaggccttgcaactgctctatcccttcacaggtttcaactctagctctcaatctcttcattttctaccatcactttcatgttttttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4172255 |
ggtggtggcattgcaggccttgcaactgctctatcccttcacaggtttcaactctagctctcaatctcttcattttctaccatcactttcatgttttttc |
4172156 |
T |
|
| Q |
217 |
taacat |
222 |
Q |
| |
|
|||||| |
|
|
| T |
4172155 |
taacat |
4172150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 173
Target Start/End: Complemental strand, 4176484 - 4176336
Alignment:
| Q |
31 |
cttgtcataccagaattggatctctcagaagttccaaattaa---tcaaggttcaatcttcag---tccaaaaggaacatgttgtcattgtgggtggtgg |
124 |
Q |
| |
|
|||||| | ||||||||||||| |||||| ||||||||||| |||||| ||||||||| | || ||||||||||||||| || ||||||||||| |
|
|
| T |
4176484 |
cttgtcgtgccagaattggatccctcagatattccaaattaacaatcaaggctcaatcttctgatgtcagaaaggaacatgttgtaatcgtgggtggtgg |
4176385 |
T |
|
| Q |
125 |
cattgcaggccttgcaactgctctatcccttcacaggtttcaactctag |
173 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4176384 |
gatagcaggccttgcaactgcactatcccttcacaggtttcaactctag |
4176336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University