View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_26 (Length: 322)
Name: NF8241_high_26
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 7e-80; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 124 - 274
Target Start/End: Complemental strand, 1026249 - 1026099
Alignment:
| Q |
124 |
cttgtttaagagcaatggatgacccctaatatgactgtgagatatggtagaagtgaatcttagactcactttagcacctttaatttgcatacaacttcaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026249 |
cttgtttaagagcaatggatgacccctaatatgactgtgagatatggtagaagtgaatcttagactcactttagcacctttaatttgcatacaacttcaa |
1026150 |
T |
 |
| Q |
224 |
aaggaaatatgcaacaaaatgatcatagatataagatgtatgtaaatctta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026149 |
aaggaaatatgcaacaaaatgatcatagatataagatgtatgtaaatctta |
1026099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 1026372 - 1026311
Alignment:
| Q |
1 |
ttgatgcatttttacatatctactagctaagctatttactactatccttcaaccttaacaat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026372 |
ttgatgcatttttacatatctactagctaagctatttactactatccttcaaccttaacaat |
1026311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 267 - 307
Target Start/End: Complemental strand, 1026058 - 1026018
Alignment:
| Q |
267 |
aaatcttaagtccagaggttccagatttaaacatcactaat |
307 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
1026058 |
aaatcttaagtccaaaggttccagattcaaacatcactaat |
1026018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University