View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_3 (Length: 607)
Name: NF8241_high_3
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 12 - 135
Target Start/End: Complemental strand, 35041319 - 35041195
Alignment:
| Q |
12 |
gagaagaaccttatagaaatttgnnnnnnnagatccacttttcgctttatctttg-tgtatatactcttttacggagttgtgaatactccctagtattta |
110 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35041319 |
gagaagaaccttgtagaaatttgtttttttagacccacttttcgttttatctttgctgtatatactcttttaaggagttgtgaatactccctagtattta |
35041220 |
T |
 |
| Q |
111 |
tttttctctattcaagaaaatttga |
135 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35041219 |
tttttctctattcaagaaaatttga |
35041195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University