View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8241_high_3 (Length: 607)

Name: NF8241_high_3
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8241_high_3
NF8241_high_3
[»] chr8 (1 HSPs)
chr8 (12-135)||(35041195-35041319)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 12 - 135
Target Start/End: Complemental strand, 35041319 - 35041195
Alignment:
12 gagaagaaccttatagaaatttgnnnnnnnagatccacttttcgctttatctttg-tgtatatactcttttacggagttgtgaatactccctagtattta 110  Q
    |||||||||||| ||||||||||       ||| |||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||    
35041319 gagaagaaccttgtagaaatttgtttttttagacccacttttcgttttatctttgctgtatatactcttttaaggagttgtgaatactccctagtattta 35041220  T
111 tttttctctattcaagaaaatttga 135  Q
    |||||||||||||||||||||||||    
35041219 tttttctctattcaagaaaatttga 35041195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University