View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_31 (Length: 304)
Name: NF8241_high_31
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_31 |
 |  |
|
| [»] scaffold0886 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 4 - 288
Target Start/End: Original strand, 6001422 - 6001692
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgcttnnnnnnnn |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
6001422 |
gagtttggcggtataggatgaaggtttctcgcggtgtcaacctagttggaatgtcgatgttgcctcttaatgtttgtcctctctccttgct--------- |
6001512 |
T |
 |
| Q |
104 |
nnnnttgatgctcaaaaattg---aattgctttcattcatcacgtgacatgagtttttctataaatagacttatatttgaggcaaaataacaaacggaat |
200 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001513 |
--------tgaaaaaaaattgttgaattgctttcattcatcacgtgacatgagtttttctataaatagacttatatttgaggcaaaataacaaacggaat |
6001604 |
T |
 |
| Q |
201 |
ttatggttccttatgattcaaaactctactgaaattatttctaaatgtctcttcttttctctagtgctacaaaatattggggtaaact |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001605 |
ttatggttccttatgattcaaaactctactgaaattatttctaaatgtctcttcttttctctagtgctacaaaatattggggtaaact |
6001692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 6 - 85
Target Start/End: Complemental strand, 17959976 - 17959897
Alignment:
| Q |
6 |
gtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctct |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| | || ||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
17959976 |
gtttggcggtataggatgaaggtttctcgtggtgcctacctagttaggatgtcgatgttgcctcttaatgcctgtcctct |
17959897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 21593183 - 21593274
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || ||||||||||||| |||| |||| |||| ||||| ||||||||||| |||||||| ||| | ||||||| ||||||||| |
|
|
| T |
21593183 |
gagtttggcggcataggatgaaggtctctcggggtgccaacctagttggaatgtcgatgatgcctcttgatgcctgtcctctctccttgctt |
21593274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 10568378 - 10568287
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| | ||||||| |||| |||| ||||| | | |||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
10568378 |
gagtttggcggcataggatggaagtttctcggggtgccaacctagttggtaagtcgatgttgcctcttgatgtctgtcctctctccttgctt |
10568287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 95
Target Start/End: Original strand, 17274722 - 17274801
Alignment:
| Q |
16 |
ataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||||||| |||| |||| | |||||||||||||||||| ||||| |||| | ||||||||| |
|
|
| T |
17274722 |
ataggatggagatttctcacggtgccaaccaagttgggatgtcgatgttgcctcttgatgtctgtccattctccttgctt |
17274801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 19068772 - 19068681
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| |||||||||| |||| |||| ||||| | |||||||||||||||||||||||| ||||||| || |||||| |
|
|
| T |
19068772 |
gagtttggcggcataggatggaggtttctcagggtgccaacctagtttggatgtcgatgttgcctcttaatgtctgtcctctctcattgctt |
19068681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 5781158 - 5781067
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
||||||||||| |||||||| | ||||||| | || |||| ||||| | |||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
5781158 |
gagtttggtggcataggatggaagtttctcgggatgccaacctagttgggatgtcgatgttgcctcttaatgtctgtcctccctccttgctt |
5781067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 32569830 - 32569921
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || ||||||| ||||||||| |||||||| ||||| | |||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
32569830 |
gagtttggcggcataggatagaggtttctcgaggtgtcaatctagttgggatgtcgatgttgcctcttaatgactgtcctctctccttgctt |
32569921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 3056937 - 3057028
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| ||||||||| ||| |||||||||| | |||||||||||| ||||| ||| | |||| || ||||||||| |
|
|
| T |
3056937 |
gagtttggcggcataggatggaggtttctcggggtaccaacttagttgggatgtcgatgttgtctcttgatgcctgtccactctccttgctt |
3057028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 14982390 - 14982478
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| | ||||||| ||||||||| |||| | ||||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
14982390 |
gagtttggcggcataggatggaagtttctcgaggtgtcaaccaagttgggatgtcgatgttgcctct---tgtctgtcctctctccttgctt |
14982478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 36802343 - 36802252
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| ||||||||| |||| |||| ||||| ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
36802343 |
gagtttggcggcataggatggaggtttctcggggtgccaacctagttgagatgtcgatgttgcctcttaatacccgtcctctctccttgctt |
36802252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 12102809 - 12102900
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || ||||||||||| |||||| | | |||| ||||| | |||||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
12102809 |
gagtttggcggcataggatgaagatttctcgggataccaacatagttgggatgtcgatgttgcctcttgatgtatgtcctctctccttgctt |
12102900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 29216603 - 29216694
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| |||| ||||||| || | ||||||||| |||||||| ||| ||||||| ||||||||| |
|
|
| T |
29216603 |
gagtttggcggtataggatggaggtctctctaggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgctt |
29216694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 29329902 - 29329993
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| |||| ||||||| || | ||||||||| |||||||| ||| ||||||| ||||||||| |
|
|
| T |
29329902 |
gagtttggcggtataggatggaggtctctctaggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgctt |
29329993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 95
Target Start/End: Original strand, 14073790 - 14073879
Alignment:
| Q |
5 |
agtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
||||||| || |||||||| |||||||||| |||| |||| ||||| | | |||||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
14073790 |
agtttggcggcataggatggaggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatg-ctgtcctctctccttgctt |
14073879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 95
Target Start/End: Original strand, 14383818 - 14383907
Alignment:
| Q |
5 |
agtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
||||||| || |||||||| |||||||||| |||| |||| ||||| | | |||||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
14383818 |
agtttggcggcataggatggaggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatg-ctgtcctctctccttgctt |
14383907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 3399617 - 3399538
Alignment:
| Q |
16 |
ataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||| | | ||||||||||||| || ||||| |||||| ||||||||| |
|
|
| T |
3399617 |
ataggatgaaggtttctcggggtgccaacctagttggtaagtcgatgttgccttttgatgtctatcctctctccttgctt |
3399538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 8667175 - 8667085
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| ||||||||| ||| |||| ||||||| |||||||||||||||||| ||| | |||| || ||||||||| |
|
|
| T |
8667175 |
gagtttggcggcataggatggaggtttctcggggtc-caacctagttaggatgtcgatgttgcctcttgatgcctgtccactctccttgctt |
8667085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 77
Target Start/End: Original strand, 4936025 - 4936098
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtc |
77 |
Q |
| |
|
|||||||| ||| || |||||||||||| | |||| |||||||||| | ||||||||||| |||||| ||||| |
|
|
| T |
4936025 |
gagtttggcggtgtatgatgaaggtttcgcggggtgccaacttagttgggatgtcgatgtttcctcttgatgtc |
4936098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 20808834 - 20808743
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt |
95 |
Q |
| |
|
|||||||| || |||||||| |||| | ||| |||||||||||||| | ||||||||| || ||||| ||| | ||||||| ||||||||| |
|
|
| T |
20808834 |
gagtttggcggcataggatggaggtctatcaaagtgtcaacttagttgggatgtcgatgatgtctcttgatgcctgtcctctctccttgctt |
20808743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0886 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0886
Description:
Target: scaffold0886; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 2782 - 2854
Alignment:
| Q |
4 |
gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgt |
76 |
Q |
| |
|
|||||||| || |||||||| ||||||||| ||| |||| ||||| | |||||||||||||||||| |||| |
|
|
| T |
2782 |
gagtttggcggcataggatggaggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgt |
2854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University