View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8241_high_31 (Length: 304)

Name: NF8241_high_31
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8241_high_31
NF8241_high_31
[»] chr8 (5 HSPs)
chr8 (4-288)||(6001422-6001692)
chr8 (6-85)||(17959897-17959976)
chr8 (4-95)||(21593183-21593274)
chr8 (4-95)||(10568287-10568378)
chr8 (16-95)||(17274722-17274801)
[»] chr5 (2 HSPs)
chr5 (4-95)||(19068681-19068772)
chr5 (4-95)||(5781067-5781158)
[»] chr6 (3 HSPs)
chr6 (4-95)||(32569830-32569921)
chr6 (4-95)||(3056937-3057028)
chr6 (4-95)||(14982390-14982478)
[»] chr2 (4 HSPs)
chr2 (4-95)||(36802252-36802343)
chr2 (4-95)||(12102809-12102900)
chr2 (4-95)||(29216603-29216694)
chr2 (4-95)||(29329902-29329993)
[»] chr7 (3 HSPs)
chr7 (5-95)||(14073790-14073879)
chr7 (5-95)||(14383818-14383907)
chr7 (16-95)||(3399538-3399617)
[»] chr4 (2 HSPs)
chr4 (4-95)||(8667085-8667175)
chr4 (4-77)||(4936025-4936098)
[»] chr1 (1 HSPs)
chr1 (4-95)||(20808743-20808834)
[»] scaffold0886 (1 HSPs)
scaffold0886 (4-76)||(2782-2854)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 4 - 288
Target Start/End: Original strand, 6001422 - 6001692
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgcttnnnnnnnn 103  Q
    |||||||| ||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||  ||||||| ||||||||             
6001422 gagtttggcggtataggatgaaggtttctcgcggtgtcaacctagttggaatgtcgatgttgcctcttaatgtttgtcctctctccttgct--------- 6001512  T
104 nnnnttgatgctcaaaaattg---aattgctttcattcatcacgtgacatgagtttttctataaatagacttatatttgaggcaaaataacaaacggaat 200  Q
            ||   ||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6001513 --------tgaaaaaaaattgttgaattgctttcattcatcacgtgacatgagtttttctataaatagacttatatttgaggcaaaataacaaacggaat 6001604  T
201 ttatggttccttatgattcaaaactctactgaaattatttctaaatgtctcttcttttctctagtgctacaaaatattggggtaaact 288  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6001605 ttatggttccttatgattcaaaactctactgaaattatttctaaatgtctcttcttttctctagtgctacaaaatattggggtaaact 6001692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 6 - 85
Target Start/End: Complemental strand, 17959976 - 17959897
Alignment:
6 gtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctct 85  Q
    |||||| |||||||||||||||||||||  |||| | || ||||||| |||||||||||||||||||||| | |||||||    
17959976 gtttggcggtataggatgaaggtttctcgtggtgcctacctagttaggatgtcgatgttgcctcttaatgcctgtcctct 17959897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 21593183 - 21593274
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || ||||||||||||| ||||  |||| |||| ||||| ||||||||||| |||||||| ||| | ||||||| |||||||||    
21593183 gagtttggcggcataggatgaaggtctctcggggtgccaacctagttggaatgtcgatgatgcctcttgatgcctgtcctctctccttgctt 21593274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 10568378 - 10568287
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| | |||||||  |||| |||| ||||| | | |||||||||||||||| ||||| ||||||| |||||||||    
10568378 gagtttggcggcataggatggaagtttctcggggtgccaacctagttggtaagtcgatgttgcctcttgatgtctgtcctctctccttgctt 10568287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 95
Target Start/End: Original strand, 17274722 - 17274801
Alignment:
16 ataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||||||| ||||  |||| | |||||||||||||||||| ||||| ||||  | |||||||||    
17274722 ataggatggagatttctcacggtgccaaccaagttgggatgtcgatgttgcctcttgatgtctgtccattctccttgctt 17274801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 19068772 - 19068681
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| |||||||||| |||| |||| ||||| | |||||||||||||||||||||||| ||||||| || ||||||    
19068772 gagtttggcggcataggatggaggtttctcagggtgccaacctagtttggatgtcgatgttgcctcttaatgtctgtcctctctcattgctt 19068681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 5781158 - 5781067
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    ||||||||||| |||||||| | |||||||  | || |||| ||||| | |||||||||||||||||||||||| ||||||  |||||||||    
5781158 gagtttggtggcataggatggaagtttctcgggatgccaacctagttgggatgtcgatgttgcctcttaatgtctgtcctccctccttgctt 5781067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 32569830 - 32569921
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||  |||||||||  ||||||||  ||||| | |||||||||||||||||||||| | ||||||| |||||||||    
32569830 gagtttggcggcataggatagaggtttctcgaggtgtcaatctagttgggatgtcgatgttgcctcttaatgactgtcctctctccttgctt 32569921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 3056937 - 3057028
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| |||||||||  |||  |||||||||| | |||||||||||| ||||| ||| | |||| || |||||||||    
3056937 gagtttggcggcataggatggaggtttctcggggtaccaacttagttgggatgtcgatgttgtctcttgatgcctgtccactctccttgctt 3057028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 14982390 - 14982478
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| | |||||||  |||||||||  |||| | |||||||||||||||||   |||| ||||||| |||||||||    
14982390 gagtttggcggcataggatggaagtttctcgaggtgtcaaccaagttgggatgtcgatgttgcctct---tgtctgtcctctctccttgctt 14982478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 36802343 - 36802252
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| |||||||||  |||| |||| |||||   |||||||||||||||||||||  | ||||||| |||||||||    
36802343 gagtttggcggcataggatggaggtttctcggggtgccaacctagttgagatgtcgatgttgcctcttaatacccgtcctctctccttgctt 36802252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 12102809 - 12102900
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || ||||||||||| ||||||  | |  |||| ||||| | |||||||||||||||||| ||||  ||||||| |||||||||    
12102809 gagtttggcggcataggatgaagatttctcgggataccaacatagttgggatgtcgatgttgcctcttgatgtatgtcctctctccttgctt 12102900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 29216603 - 29216694
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| ||||||||||| |||| ||||  |||| ||||||| || | ||||||||| |||||||| |||   ||||||| |||||||||    
29216603 gagtttggcggtataggatggaggtctctctaggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgctt 29216694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 29329902 - 29329993
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| ||||||||||| |||| ||||  |||| ||||||| || | ||||||||| |||||||| |||   ||||||| |||||||||    
29329902 gagtttggcggtataggatggaggtctctctaggtgccaacttaattgggatgtcgatgatgcctcttgatgcatgtcctctctccttgctt 29329993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 95
Target Start/End: Original strand, 14073790 - 14073879
Alignment:
5 agtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    ||||||| || |||||||| |||||||||| |||| |||| ||||| | | |||||||||||||||| ||| | ||||||| |||||||||    
14073790 agtttggcggcataggatggaggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatg-ctgtcctctctccttgctt 14073879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 95
Target Start/End: Original strand, 14383818 - 14383907
Alignment:
5 agtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    ||||||| || |||||||| |||||||||| |||| |||| ||||| | | |||||||||||||||| ||| | ||||||| |||||||||    
14383818 agtttggcggcataggatggaggtttctcagggtgccaacctagttggtaagtcgatgttgcctcttgatg-ctgtcctctctccttgctt 14383907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 3399617 - 3399538
Alignment:
16 ataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    ||||||||||||||||||  |||| |||| ||||| | | ||||||||||||| || |||||  |||||| |||||||||    
3399617 ataggatgaaggtttctcggggtgccaacctagttggtaagtcgatgttgccttttgatgtctatcctctctccttgctt 3399538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 8667175 - 8667085
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| |||||||||  |||  |||| ||||||| |||||||||||||||||| ||| | |||| || |||||||||    
8667175 gagtttggcggcataggatggaggtttctcggggtc-caacctagttaggatgtcgatgttgcctcttgatgcctgtccactctccttgctt 8667085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 77
Target Start/End: Original strand, 4936025 - 4936098
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtc 77  Q
    |||||||| ||| || |||||||||||| |  |||| |||||||||| | ||||||||||| |||||| |||||    
4936025 gagtttggcggtgtatgatgaaggtttcgcggggtgccaacttagttgggatgtcgatgtttcctcttgatgtc 4936098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 20808834 - 20808743
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgtcagtcctctttccttgctt 95  Q
    |||||||| || |||||||| |||| | |||  |||||||||||||| | ||||||||| || ||||| ||| | ||||||| |||||||||    
20808834 gagtttggcggcataggatggaggtctatcaaagtgtcaacttagttgggatgtcgatgatgtctcttgatgcctgtcctctctccttgctt 20808743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0886 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0886
Description:

Target: scaffold0886; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 2782 - 2854
Alignment:
4 gagtttggtggtataggatgaaggtttctcacggtgtcaacttagttagaatgtcgatgttgcctcttaatgt 76  Q
    |||||||| || |||||||| |||||||||  |||  |||| ||||| | |||||||||||||||||| ||||    
2782 gagtttggcggcataggatggaggtttctcgaggtaccaacctagttgggatgtcgatgttgcctcttgatgt 2854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University