View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_48 (Length: 254)
Name: NF8241_high_48
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 1026691 - 1026453
Alignment:
| Q |
12 |
gagatgaatcttataatcagaaacaattctttggagttttaaattttgaagcttcactcttactctaaggtaacttactctcttaagctctcnnnnnnnc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1026691 |
gagatgaatcttataatcagaaacaattctttggagttttaaattttgaagcttcactcttactctaaggtaacttactctcttaagctctctttttttc |
1026592 |
T |
 |
| Q |
112 |
ttcagtcaatgtaatatgtacattattagattaatgcactttgttttataagttctatactacggtcttgaccttaatttgagcttcaaaattgacaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026591 |
ttcagtcaatgtaatatgtacattattagattaatgcactttgttttataagttctatactacggtcttgaccttaatttgagcttcaaaattgacaata |
1026492 |
T |
 |
| Q |
212 |
agaatataatgcatgcaatttatatttatgatataatgt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026491 |
agaatataatgcatgcaatttatatttatgatataatgt |
1026453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University