View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_63 (Length: 229)
Name: NF8241_high_63
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 30 - 213
Target Start/End: Complemental strand, 4143377 - 4143200
Alignment:
| Q |
30 |
gaatcctctattcaaaacgtacgatttgatatagtgctttaacttttgtaccnnnnnnngtttgcaatgaatcacatgatgaaccaattaacaaacatat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4143377 |
gaatcctctattcaaaacgtacgatttgatatagtgctttaacttttgtacctaaaaaagtttgcaatgaatcacatgatgaaccaattaacaaac--at |
4143280 |
T |
 |
| Q |
130 |
ccccaattggagacaaaatcgaaatccaatatggaatttcataaaaggtgctttaattaatttagtataattatcaattaaact |
213 |
Q |
| |
|
||||||||||||||||||| ||||| | |||| ||||||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
4143279 |
ccccaattggagacaaaattgaaattctatatagaatttcataaaaggtgct----ttaatttagtattattatgaattaaact |
4143200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University