View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_high_69 (Length: 205)
Name: NF8241_high_69
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_high_69 |
 | |
|
| [»] scaffold0856 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 30272877 - 30273044
Alignment:
| Q |
19 |
tataatgccataggaaggaggtagaagaatcatcaggaagattacaatgaagaaggacataagagagggagagagccatagggaggacccttgaaattgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30272877 |
tataatgccataggaaggaggtagaagaatcatcaggaagattacaatgaagaaggacata-gagagggagagagccatagggaggaccctcgaaattgt |
30272975 |
T |
|
| Q |
119 |
ttattgtttcaagtggtttcttccaaattgataatttcagtttctttgttctgcaccttcatgtcatct |
187 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30272976 |
ttgttgtttcaattggtttcttccaaattgataatttcagtttctttgttctgcaccttcatgtcatct |
30273044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 4601 - 4547
Alignment:
| Q |
22 |
aatgccataggaaggaggtagaagaatcatcaggaagattacaatgaagaaggac |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
4601 |
aatgccataggaaggaggtagtagaatcatcaggaaaattacaatgaagagggac |
4547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 187
Target Start/End: Original strand, 12089163 - 12089212
Alignment:
| Q |
138 |
cttccaaattgataatttcagtttctttgttctgcaccttcatgtcatct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| || || ||||||| |||| |
|
|
| T |
12089163 |
cttccaaattgataatttcagtttctttgttttgtacattcatgttatct |
12089212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University