View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_25 (Length: 395)
Name: NF8241_low_25
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_25 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 146 - 382
Target Start/End: Original strand, 3181 - 3419
Alignment:
| Q |
146 |
ccatgtttttcagggacagctattgtacccgcnnnnnnnnn-tacaatgcactcacaagtgttagttagcttagaccctctccaaaaaataaaagtgtta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
3181 |
ccatgtttttcagggacagctattgtacccgcaaaaaacaaatacagttcactcacaagtgttagttagcttaaaccctctccaaaaaa-aaaagtgtta |
3279 |
T |
|
| Q |
245 |
gcttagaaattacaattgaattgtgtgaatgcatatatgaagattaaattcaatttttattaccaa--nnnnnnnnnatgcaattaggaagtttttattg |
342 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3280 |
gcttaaaaattacaattgaattgtgtgaatgcatatttaaagattaaattcaatttttattaccaatttttttttttatgcaattaggaagtttttattg |
3379 |
T |
|
| Q |
343 |
aaattttgtttatcactttcaatttcacctctgtccttct |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3380 |
aaattttgtttatcactttcaatttcacctctgtccttct |
3419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University