View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_28 (Length: 383)
Name: NF8241_low_28
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_28 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 151 - 383
Target Start/End: Complemental strand, 39302455 - 39302223
Alignment:
| Q |
151 |
acttgttttgtttgtattttgggtacctcaaaaatgtcgctttcgcaaggtccttatggaatgtgatttgaaagttgtcgtaggttgagatgattgctaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39302455 |
acttgttttgtttgtattttgggtacctcaaaaatgtcgctttcgcaaggtccttatggaatgtgatttgaaagttgtcgtaggttgagatgattgctaa |
39302356 |
T |
 |
| Q |
251 |
tcagattgatagtattaatattattagtccttattggcgattgcacgaagaaatcagattgataacaacttatatatattatcccactaaataaaatnnn |
350 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39302355 |
tcagattgatagtattagtattattagtccttattggcgattgcacgaagaaatcagattgataacaacttatatatattatcccactaaataaataaaa |
39302256 |
T |
 |
| Q |
351 |
nnnntccaagaacaaccgttgtccctctattta |
383 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39302255 |
aacatccaagaacaaccgttgtccctctattta |
39302223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 39302648 - 39302477
Alignment:
| Q |
1 |
ttggtgcttgaatccagatagaattattgagctgaatcatggttctgtttttcaacatatccaagtttgttggaaggtccttccattagattagatattg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39302648 |
ttggtgcttgaattcagatagaattattgagctgaatcatggttctgtttttcaacatatccaattttgttggaaggtccttccattagattagatattg |
39302549 |
T |
 |
| Q |
101 |
tacaaatataaatgggtacgtatgtcttgaataaccatagagcggcatgtacttgttttgtttgtattttgg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39302548 |
tacaaatataaatgggtacgtatgtcttgaataaccatagagcggcatgtacttgttttgttcgtattttgg |
39302477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University