View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_42 (Length: 310)
Name: NF8241_low_42
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 15 - 181
Target Start/End: Complemental strand, 50554176 - 50554010
Alignment:
| Q |
15 |
ttgggagtaaagttttgggagtttgttagtccgccacaagttgaaaatgaactcacagcatcctgcaattcaatcatgaaaaggttacataagctggaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50554176 |
ttgggagtaaagttttgggagtttgttagtccaccacaagttgaaaatgaactcacaacatcctgcaattcaatcatgaaaaggttgcataagctggaac |
50554077 |
T |
|
| Q |
115 |
taacattttgatcgtattctaaaataaattcttcttaagggctgtagctgttgttacatcaatcttt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50554076 |
taacattttgatcgtattctaaaataaattcttcttgagggctgtagctgttgttacatcaatcttt |
50554010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 186 - 291
Target Start/End: Complemental strand, 50553908 - 50553802
Alignment:
| Q |
186 |
gatagtggcggtagtattaggatttaggagtactttataaataaatgatgggaat-ggacgaagtcttgcatgttgacatgcttaagaaaaaatagaaag |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50553908 |
gatagtggcggtagtattaggatttaggagtactttataaataaatgatgggaatgggacgaagtcttgcatgttcacatgcttaagaaaaaatagaaag |
50553809 |
T |
|
| Q |
285 |
accaaat |
291 |
Q |
| |
|
| ||||| |
|
|
| T |
50553808 |
agcaaat |
50553802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University