View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_50 (Length: 282)
Name: NF8241_low_50
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 42550665 - 42550923
Alignment:
| Q |
18 |
ggaagcgccgtctttgacgccgtcaactaggtcattttcatttgagccgtcggaagaagtagcgttggatgaaaacgtgaactcactttctccccagctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42550665 |
ggaagcgccgtctttgacgccgtcaactaggtcattttcatttgagccgtcggaagacgtagcgttggatgaaaacgtaaactcactttctccccagctg |
42550764 |
T |
|
| Q |
118 |
gtactgcaacaatctgaagagacggtggtgaaccttttggcactgaatatggcatcttcgctaaacgacgttggtttataatctcgttcctgcataagta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42550765 |
ttactgcaacaatctgaagagacggtggtgaaccttttggcactgaatatggcatcttcgctaaacgacgttggtttataatctcgttcctgcataagta |
42550864 |
T |
|
| Q |
218 |
gttcccggaaagatctcttacacctcaatacaccttcacttccctcttccttctctgct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42550865 |
gttcccggaaagatctcttacacctcaatacaccttcacttccctcttccttcactgct |
42550923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University