View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_51 (Length: 281)
Name: NF8241_low_51
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 106 - 263
Target Start/End: Original strand, 30766885 - 30767042
Alignment:
| Q |
106 |
gacttccgaccgacctaaccattaaaaatataatcgtattagcatatccaatctaattcaaaccacggtaacaaagttgaaaaattatataaaaaataac |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30766885 |
gacttccgaccgacctaaccattacaaatataatcgtattagcatatccaatctaatgcaaaccacggtaacaaagttgaaaaattatataaaaaataac |
30766984 |
T |
 |
| Q |
206 |
caaaactgaacatatcaacttttttcgttggattgtaaaataaaaaaccttattcttt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30766985 |
caaaactgaacatatcaacttttttcgttggattgtaaaataaaaaaccttattcttt |
30767042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 30766743 - 30766846
Alignment:
| Q |
1 |
aacaaaccactaaacatattttatcataagttcacaatgccaaaatgcatagaaatgtcgatcatattttttagtagatagacgaaatgtcaatttatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||| |||||||| || |
|
|
| T |
30766743 |
aacaaaccactaaacatattttatcataagttcacaatgccaaaatgcaaagaaatgtcaatccaattttttagtagatagacgaaatatcaatttacca |
30766842 |
T |
 |
| Q |
101 |
ttga |
104 |
Q |
| |
|
|||| |
|
|
| T |
30766843 |
ttga |
30766846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University