View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_53 (Length: 278)
Name: NF8241_low_53
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 21 - 260
Target Start/End: Original strand, 42177743 - 42177981
Alignment:
| Q |
21 |
agagatgatataaatagacatggtccttcnnnnnnnngggaaagcaaagttccacaatacattattgaattagagtaggcaaaagggaataatccaagct |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177743 |
agagatgatataaatagacacggtccttcttttttt-gggaaagcaaagttccacaatacattattgaattagagtaggcaaaagggaataatccaagct |
42177841 |
T |
|
| Q |
121 |
agaaagtaaaataactaaaatgttttatttaggttgcaaagtcggtgtttccttggcggtggtagctttggaatcaaagcaaaatgacaaaggtgatagg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177842 |
agaaagtaaaataactaaaatgttttatttaggttacaaagtcggtgtttccttggcggtggtagctttggaatcaaagcaaaatgacaaaggtgatagg |
42177941 |
T |
|
| Q |
221 |
gagagggaccattgcaaacaagaatagatagcataacacc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177942 |
gagagggaccattgcaaacaagaatagatagcataacacc |
42177981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University