View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_57 (Length: 263)
Name: NF8241_low_57
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_57 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 67 - 263
Target Start/End: Complemental strand, 245298 - 245102
Alignment:
| Q |
67 |
agtttcgtaaatacactttttattaaacttcattttttaaacgtacattaggataaatgttagctcnnnnnnnnnnnnnnnnnnnnnnngacaaaataaa |
166 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
245298 |
agtttcgtaaatatactttttattaaacttcatttttcaaacgtacattaggataaatgttagctctttgttttttatttttctgttttgacaaaataaa |
245199 |
T |
 |
| Q |
167 |
tttgagttcttttagaacaggtaaaaaatgtgttttctctaacataatttatgtttcatactattatgtagctcatttttatcgcaacaagctttcc |
263 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
245198 |
tctgagttcttttagaacaggtaaaaaatgtgttttctctaacataatttatgtttcatactatcatgtagctcatttttatcgcaacaagctttcc |
245102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University