View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_59 (Length: 260)
Name: NF8241_low_59
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 45558358 - 45558141
Alignment:
| Q |
19 |
gagtgagcttcgtgaatcaattaatcaaattaacgaagaggaagaggaagagga------cgagcacgaggatgactacgttaacgactacgacgaacga |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45558358 |
gagtgagcttcgtgaatctattaatcaaattaacgaagaggaagaggaagaggaagaggacgagcacgaggatgattacgttaacgactacgacgaacga |
45558259 |
T |
 |
| Q |
113 |
accaaacgatttgaacatcaatctttaattgatgattttttggaattgtttcggcactctcttaaaccgaaccttaagactatgtttacagattatttgt |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45558258 |
atcaaacgatttgaacatcaatctttaattgatgattttttggaattgtttcggcactctcttaaaccgaaccttaagactatgtttacagattatttgt |
45558159 |
T |
 |
| Q |
213 |
ataacaatagtaaagttg |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45558158 |
ataacaatagtaaagttg |
45558141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University