View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8241_low_59 (Length: 260)

Name: NF8241_low_59
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8241_low_59
NF8241_low_59
[»] chr4 (1 HSPs)
chr4 (19-230)||(45558141-45558358)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 45558358 - 45558141
Alignment:
19 gagtgagcttcgtgaatcaattaatcaaattaacgaagaggaagaggaagagga------cgagcacgaggatgactacgttaacgactacgacgaacga 112  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||      ||||||||||||||| ||||||||||||||||||||||||    
45558358 gagtgagcttcgtgaatctattaatcaaattaacgaagaggaagaggaagaggaagaggacgagcacgaggatgattacgttaacgactacgacgaacga 45558259  T
113 accaaacgatttgaacatcaatctttaattgatgattttttggaattgtttcggcactctcttaaaccgaaccttaagactatgtttacagattatttgt 212  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45558258 atcaaacgatttgaacatcaatctttaattgatgattttttggaattgtttcggcactctcttaaaccgaaccttaagactatgtttacagattatttgt 45558159  T
213 ataacaatagtaaagttg 230  Q
    ||||||||||||||||||    
45558158 ataacaatagtaaagttg 45558141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University