View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_68 (Length: 243)
Name: NF8241_low_68
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 39072299 - 39072524
Alignment:
| Q |
1 |
attggatttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaataacttttgttgcatactgaacttgacctggacaaacacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39072299 |
attggatttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaataacttttgctgcatactgaacttgacctggacaaacacat |
39072398 |
T |
|
| Q |
101 |
cagcaactaaagttatcaattgcaggctttgagagaaaaaattaacaatgtcaaattttgtttattatcgggtacaacaattacctatttcattgacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39072399 |
cagcaactaaagttatcaattgcaggctttgagagaaaaaattaacaatgtcaaattttgtttattatc-ggtacaacaattacctatttcattgacaaa |
39072497 |
T |
|
| Q |
201 |
gtagcatagcag-cagacagcaggact |
226 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
39072498 |
gtagcatagcagtcagacagcaggact |
39072524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 116
Target Start/End: Original strand, 40170346 - 40170455
Alignment:
| Q |
8 |
ttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaata-acttttgttgcatactgaacttgacctggacaaacacatcagcaa |
106 |
Q |
| |
|
|||||| || ||||| || |||| |||||||||||||| |||||| |||||||| ||| || |||||| ||||||| |||| ||||||| ||||| |
|
|
| T |
40170346 |
ttagcataaggtaccgtacataactgattctgaatgacgcacaaatagccaatagccttctgctgcatattgaacttaaccttcacaaacatatcagatg |
40170445 |
T |
|
| Q |
107 |
ctaaagttat |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
40170446 |
ctaaagttat |
40170455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University