View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_74 (Length: 237)
Name: NF8241_low_74
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 44 - 143
Target Start/End: Complemental strand, 7442704 - 7442605
Alignment:
| Q |
44 |
tttctcattccctaaccctaaccaatgagagacatctttttaatgtgctctcactcaaatcaagtctagtctttctttcttcttgtaagcaatgatcaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7442704 |
tttctcattccctaaccctaaccaatgagagacatctttttaatctgctctcactcaaatcaagtctagtctttctttcttcttgtaagcaatgatcaaa |
7442605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 40 - 143
Target Start/End: Complemental strand, 7457986 - 7457883
Alignment:
| Q |
40 |
atattttctcattccctaaccctaaccaatgagagacatctttttaatgtgctctcactcaaatcaagtctagtctttctttcttcttgtaagcaatgat |
139 |
Q |
| |
|
||||||||||| |||||| |||||||||| ||||||||||||||| || |||||||||||||||||||||||||||| ||| |||||||||||||| || |
|
|
| T |
7457986 |
atattttctcactccctatccctaaccaacgagagacatctttttcatcagctctcactcaaatcaagtctagtctttgtttgttcttgtaagcaattat |
7457887 |
T |
 |
| Q |
140 |
caaa |
143 |
Q |
| |
|
|||| |
|
|
| T |
7457886 |
caaa |
7457883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 186 - 237
Target Start/End: Complemental strand, 7441920 - 7441869
Alignment:
| Q |
186 |
atttggtatctgttctatctatccacgccattcattggataacttttagtct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7441920 |
atttggtatctgttctatctatccacgccattcattggataacttttagtct |
7441869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 7443777 - 7443726
Alignment:
| Q |
1 |
cttgattgattaatggttggatcaattaatcagcatatcatattttctcatt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7443777 |
cttgattgattaatggttggatcaattaatcagcatatcatattttctcatt |
7443726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University