View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_76 (Length: 233)
Name: NF8241_low_76
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1509339 - 1509117
Alignment:
| Q |
1 |
gttgcaagaattgcacgttaatcctgacattgnnnnnnn-gattccttatttgaaagaagagaaaatgaaaatgaagagaattagggattatatatagtt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1509339 |
gttgcaagaattgcacgttaatcctgacattgttttttttgattccttagttgaaagaagagaaaatgaaaatgaagagaattagggattatatatagtt |
1509240 |
T |
 |
| Q |
100 |
ggttataggcaaaagaaattaattattatttttgtttgtttgtcggcgaaacggtgaagattgaacgaaccaaggttttgcttgcaatcagcgcttgcgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1509239 |
ggttataggcaaaagaaattaattattatttttgtttgtttgtcggcgaaacggtgaagattgaacgaaccaaggttttgcttgcaatcagcgcttgcgt |
1509140 |
T |
 |
| Q |
200 |
aatgtcgttgtggaccggttcat |
222 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
1509139 |
aatgacgttgtggaccggttcat |
1509117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University