View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_78 (Length: 231)
Name: NF8241_low_78
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 216
Target Start/End: Complemental strand, 20926217 - 20926090
Alignment:
| Q |
101 |
ttggctaagtgtttgattcttctagctcaaggtggaaatcataggc------------ttgttgatgagaataaaagggaaaagggtagtcatggaaatn |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20926217 |
ttggctaagtgtttgattcttcttgctcaaggtggaaatcatagggaagatggtggagttgttgatgagaataaaagggtaaagggtagtcatggaaata |
20926118 |
T |
 |
| Q |
189 |
nnnnnnttggtgagactagcacaaaact |
216 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20926117 |
aaaaaattggtgagactagcacaaaact |
20926090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 20926305 - 20926255
Alignment:
| Q |
13 |
tggtgttgttgctatggcatctagttgttcaagtgatgagagcaacattga |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20926305 |
tggtgttgttgctatggcatctagttgttcaagtgatgagagcaacattga |
20926255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University