View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_86 (Length: 214)
Name: NF8241_low_86
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 21 - 150
Target Start/End: Original strand, 7451742 - 7451871
Alignment:
| Q |
21 |
gtcaatactatgtaagcatttctaaccctagtcgcacaccgtgccaaaattaaagccatttaaccaagcattttgccgagatgatttaagcctcttccag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7451742 |
gtcaatactatgtaagcatttctaaccctagtcgcacaccgtgccaaaattaaagccatttaaccaagcattttgctgagatgatttaagcctcttccag |
7451841 |
T |
 |
| Q |
121 |
cttaatcagagatcgcgaattcgaaatcaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7451842 |
cttaatcagagatcgcgaattcgaaatcaa |
7451871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 7451887 - 7451922
Alignment:
| Q |
168 |
aaacagcaaatattattaaacaactagatctctgct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451887 |
aaacagcaaatattattaaacaactagatctctgct |
7451922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 203
Target Start/End: Complemental strand, 25992453 - 25992421
Alignment:
| Q |
171 |
cagcaaatattattaaacaactagatctctgct |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
25992453 |
cagcaaatattattaaacaaccagatctctgct |
25992421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University