View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_88 (Length: 205)
Name: NF8241_low_88
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 30197593 - 30197416
Alignment:
| Q |
17 |
agttaaaaggaacattggatccaaggttataccatactattattaacttttggggaaccatgatataaaacatgacctagtgaaccaaatatgatttttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30197593 |
agttaaaaggaacattggatccaaggttataccatactattattaacttttggggaaccatgatataaaacatgacctagtgaaccaaatatgatttttc |
30197494 |
T |
|
| Q |
117 |
acgcgaatgattaaggcaaccatgatatttcaatagttaatattctcgggcactcattcgccatcttattttgtctct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
30197493 |
acgcgaatgattaaggcaaccatgatatttcaatagttaatattcacggacactcattcgccatcttattttgtctct |
30197416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University