View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8241_low_89 (Length: 203)
Name: NF8241_low_89
Description: NF8241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8241_low_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 38 - 187
Target Start/End: Complemental strand, 29215324 - 29215175
Alignment:
| Q |
38 |
gtatgtgttttagggatcatcataaaaaatttatcactcaaagtaataagtaaatttctgagttgtgcttggatgatgttatctttgaattagatgctaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29215324 |
gtatgtgttttagggatcatcataaaaaatttatcactcaaagtaacaagtaaatttctgagttgtgcttggatgatgttatctttgaattagatgctaa |
29215225 |
T |
|
| Q |
138 |
agcaatggtagattttaatttttctcaatatgccattagttgatttaact |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
29215224 |
agcaatggtagattttattttttctcaatatgcaattagttgatttaact |
29215175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University