View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8242_low_11 (Length: 310)

Name: NF8242_low_11
Description: NF8242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8242_low_11
NF8242_low_11
[»] chr3 (3 HSPs)
chr3 (190-274)||(347740-347824)
chr3 (55-103)||(347889-347937)
chr3 (109-147)||(347823-347861)
[»] chr1 (1 HSPs)
chr1 (146-197)||(33317497-33317548)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 190 - 274
Target Start/End: Complemental strand, 347824 - 347740
Alignment:
190 tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct 274  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
347824 tggaaacccatctgaatctcaatcttgaaaaatttgtaacatggattccccttatgccttgatacttgatcatcatttttcttct 347740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 55 - 103
Target Start/End: Complemental strand, 347937 - 347889
Alignment:
55 tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
347937 tcaaaacatcggatcctatgttttagccaataacaaccattgtgttaaa 347889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 147
Target Start/End: Complemental strand, 347861 - 347823
Alignment:
109 aaagtcgagcatattcacttatgtggtagactaactatg 147  Q
    |||||||||||| || |||||||||||||||||||||||    
347861 aaagtcgagcatcttaacttatgtggtagactaactatg 347823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 33317497 - 33317548
Alignment:
146 tgttcgttggcattgtttgatggcacctaacctttaggcaaacctggaaacc 197  Q
    |||| |||||||||||||||||||||||||||| |  |||||| ||||||||    
33317497 tgtttgttggcattgtttgatggcacctaacctctttgcaaacatggaaacc 33317548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University