View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8242_low_13 (Length: 269)
Name: NF8242_low_13
Description: NF8242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8242_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 26915428 - 26915339
Alignment:
| Q |
1 |
tttttcaccaaacaaaactatatacccaataataatacacttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915428 |
tttttcaccaaacaaaactatatacccaataataatacatttgtgaaagagagcaagagtacgatattatgaaatttgaacgtaattgta |
26915339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University