View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8242_low_15 (Length: 250)

Name: NF8242_low_15
Description: NF8242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8242_low_15
NF8242_low_15
[»] chr4 (1 HSPs)
chr4 (1-240)||(10124903-10125142)
[»] chr3 (1 HSPs)
chr3 (146-190)||(25043422-25043466)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 10125142 - 10124903
Alignment:
1 tatttagggtatttgatcttggacaacttttaattcaaaggcatttgatttaatcatatgannnnnnnnnnnnggatatggtttagttatatggtagcct 100  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||    
10125142 tatttaggttatttgatcttggacaacttttaattcaaaggcatttgatttaatcatatgatttttactttttggatatggtttagttatatggtagcct 10125043  T
101 aaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtcataccctagtcttactcattcccttgaatttatgcattc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||     
10125042 aaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtcagaccctagtcttactcattcccttgaatttatgcatta 10124943  T
201 tttcacgtaacaaaccttttgattctacgttttctctctg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
10124942 tttcacgtaacaaaccttttgattctacgttttctctctg 10124903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 190
Target Start/End: Complemental strand, 25043466 - 25043422
Alignment:
146 atatctatccaatgtcataccctagtcttactcattcccttgaat 190  Q
    ||||||||||| ||| ||| || ||||||||||||||||||||||    
25043466 atatctatccattgttatatcccagtcttactcattcccttgaat 25043422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University