View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8242_low_15 (Length: 250)
Name: NF8242_low_15
Description: NF8242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8242_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 10125142 - 10124903
Alignment:
| Q |
1 |
tatttagggtatttgatcttggacaacttttaattcaaaggcatttgatttaatcatatgannnnnnnnnnnnggatatggtttagttatatggtagcct |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10125142 |
tatttaggttatttgatcttggacaacttttaattcaaaggcatttgatttaatcatatgatttttactttttggatatggtttagttatatggtagcct |
10125043 |
T |
 |
| Q |
101 |
aaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtcataccctagtcttactcattcccttgaatttatgcattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125042 |
aaaaaatttgcaacaagttaggagtttttgttaccagtcttgctcatatctatccaatgtcagaccctagtcttactcattcccttgaatttatgcatta |
10124943 |
T |
 |
| Q |
201 |
tttcacgtaacaaaccttttgattctacgttttctctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124942 |
tttcacgtaacaaaccttttgattctacgttttctctctg |
10124903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 190
Target Start/End: Complemental strand, 25043466 - 25043422
Alignment:
| Q |
146 |
atatctatccaatgtcataccctagtcttactcattcccttgaat |
190 |
Q |
| |
|
||||||||||| ||| ||| || |||||||||||||||||||||| |
|
|
| T |
25043466 |
atatctatccattgttatatcccagtcttactcattcccttgaat |
25043422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University