View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8242_low_19 (Length: 241)
Name: NF8242_low_19
Description: NF8242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8242_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 30868740 - 30868598
Alignment:
| Q |
17 |
gttttttactaggcggtgcgctcaatacacacactcaaactggatataaaaagttctataccggtggtcaccttttggaattcaaactctagttattagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30868740 |
gttttttactaggcggtgcgctcaatacacacactcaaactggatataaaaagttctataccggtggtcaccttttggaattcaaactctagttattagc |
30868641 |
T |
 |
| Q |
117 |
acactaacgactaacgtttcactataaaaaatgcagagacctc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30868640 |
acactaacgactaacgtttcactataaaaaatgcagacacctc |
30868598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 30868568 - 30868503
Alignment:
| Q |
176 |
ggtgagaactcatatctatgagaaacgagaacaattgtttatgttcgttagattgtgtcaaacacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30868568 |
ggtgagaactcatatctatgagaaacgagaacaattgtttatgttcgttagattgtgtcaaacacc |
30868503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 71 - 124
Target Start/End: Original strand, 32933842 - 32933895
Alignment:
| Q |
71 |
tctataccggtggtcaccttttggaattcaaactctagttattagcacactaac |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32933842 |
tctataccggtggttaccttttggaattcaaactctagttattaacatactaac |
32933895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University