View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8243_low_10 (Length: 242)
Name: NF8243_low_10
Description: NF8243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8243_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 59 - 224
Target Start/End: Original strand, 40144625 - 40144786
Alignment:
| Q |
59 |
atgccatgttacaatatttatttatattgctgtgataacatgttgaattaatcatgattataaggaattaataggcaagaaaacattgcttaatttatga |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40144625 |
atgccatgttacaatatt----tatattgctgtgataacatgttgaattattcattattataaggaattaataggcaagaaaacattgcttaatttataa |
40144720 |
T |
|
| Q |
159 |
aattatgatttttctcataaggtatagtatttatgtgttgaaggaaaatcttttgatggaaatacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40144721 |
aattatgatttttctcataaggtatagtatttatgtgttgaaggaaaatcttttgatggaaatacc |
40144786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40144566 - 40144599
Alignment:
| Q |
1 |
taaaagaacactttctcttccagttcacaaggta |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40144566 |
taaaagaacactttctcttccagttcacaaggta |
40144599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University