View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8243_low_3 (Length: 383)
Name: NF8243_low_3
Description: NF8243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8243_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 364
Target Start/End: Complemental strand, 37745231 - 37744867
Alignment:
| Q |
1 |
catattgcaggtgtttccttcgtaccagacggaggaaacaccgacttgtggcttttttaagtcggcatcggagagaccgacaccgtagaggattgcttgt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745231 |
catattgcaggtgtttccttcataccagacggaggaaacaccgacttgtggcttttttaagtcggcatcggagagaccgacaccgtagaggattgcttgt |
37745132 |
T |
 |
| Q |
101 |
gatgcgccttgggattttggttcggtgattcgggagctgtatttgttgagttttgtgggttcattggaaggggtattggtggagatggaggattttacgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37745131 |
gatgcgccttgggattttggttcggtgattcgggaactgtatttgttaagttttgtgggttcaatggaagggggattggtggagatggaggattttacgg |
37745032 |
T |
 |
| Q |
201 |
atatgcgccgagagggagtgggggtgtgagtaggaaagagggcgttgtaggttggggaaaagagagttgactgcattgttacggcggaggagtgtggaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745031 |
atatgcgccgagagggagtgggggtgtgagtaggaaagagggcggtgtaggttggggaaaagagagttgactgcattgttacggcggaggagtgtggaat |
37744932 |
T |
 |
| Q |
301 |
ggtgagggttttggagtgggcgcgg-aaatgggtttaggaatgagtagtaagggagtgttgtagg |
364 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
37744931 |
ggagagggttttggagtgggcgcggaaaatgggtttaggaaggagtagtaagtgagtgttgtagg |
37744867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University