View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8243_low_7 (Length: 289)
Name: NF8243_low_7
Description: NF8243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8243_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 26 - 273
Target Start/End: Complemental strand, 49976587 - 49976345
Alignment:
| Q |
26 |
aggaaatagagtagaagttgaagaggagaagatgatcagatcaatctatgaaggtgtagtagtaagtgggggacggaagacctacatggtgattgtaata |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976587 |
aggaaatagagtagaagttgaagaggagaagatgatca-----atctatgaaggtgtagtagtaagtgggggacggaagacctacatggtgattgtaata |
49976493 |
T |
|
| Q |
126 |
tgataccagcagaaagagactacagaaagaaaaagatattgtagaggctatagtttgagtgattgtagaagataaagagctttgaaagttctctatcagt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976492 |
tgataccagcagaaagagactacagaaagaaaaagatattgtagaggctatagtttgagtgattgtagaagataaagagctttgaaagttctctatcagt |
49976393 |
T |
|
| Q |
226 |
tcttctgctacactctctctcacttacctcccttcttcatcatacaca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976392 |
tcttctgctacactctctctcacttacctcccttcttcatcatacaca |
49976345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 180 - 246
Target Start/End: Original strand, 49954413 - 49954478
Alignment:
| Q |
180 |
ttgagtgattgtagaagataaagagctttgaaagttctctatcagttcttctgctacactctctctc |
246 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
49954413 |
ttgagtgatggtagaagataaagagctttgaaagttctctatcagttcttctgccac-ctctctctc |
49954478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University