View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8244_high_1 (Length: 245)
Name: NF8244_high_1
Description: NF8244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8244_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 19504589 - 19504447
Alignment:
| Q |
16 |
aaatacatgatctctagtggcattacacaccaaggacgttgtgatcggatcacatcgagagttgaaat----taatgatattggttctta--accgtcca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||| ||||||||||||| ||||| || |
|
|
| T |
19504589 |
aaatacatgatctctagtggcattacacaccaaggacgttgtgatcggatcacgtccagagttgaaattaattaataatattggttcttaacaccgttca |
19504490 |
T |
 |
| Q |
110 |
ttgagcttcttctttaaagtaaacattcgtttgttcacaaccc |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19504489 |
ttgatcttcttctttaaagtaaacattcgtttgttcacaaccc |
19504447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University