View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8244_high_2 (Length: 239)
Name: NF8244_high_2
Description: NF8244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8244_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 35243266 - 35243145
Alignment:
| Q |
1 |
atctctgataaaatggacggagacatgtactgtttcagcttacatcatgcagcaaaaggcgacagcaattcaaaattatatcatatcccaaaatttggat |
100 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35243266 |
atctctgataaaatgaacggagtcatgtactgtttcagcttacatcatgcagcaaaaggcgacagcaattcaaaattatatcatatcccaaaatttagat |
35243167 |
T |
 |
| Q |
101 |
tgaatatgtggcttaaggtata |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35243166 |
tgaatatgtggcttaaggtata |
35243145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 154 - 223
Target Start/End: Complemental strand, 35243149 - 35243080
Alignment:
| Q |
154 |
gtatacagcaaatagaacacagaagtggattttcatattgttcaatgaaacaggacaatcaggactattt |
223 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35243149 |
gtatacagcaaatagaacatacaagtgaattttcatattgttcaatgaaacaggacaatcaggactattt |
35243080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University