View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8245_low_5 (Length: 401)
Name: NF8245_low_5
Description: NF8245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8245_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 135 - 385
Target Start/End: Original strand, 11033731 - 11033964
Alignment:
| Q |
135 |
ggtatgtttatcaattgtaattaattaatcaaccagtaaccacatttttgtttccattgtgatcaaaccaagaaaacgggtcataaactttgataatgaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11033731 |
ggtatgtttatcaattgtaattaattaatgaaccagtaaccacatttttgtttccattgtgatcaaaccaagaaaacgggtcataaactttgataatgaa |
11033830 |
T |
|
| Q |
235 |
agcttcattcgtcattagccggcttgtcacttataaggttcaattaacatcactgttaccatttatttctttctctctagcttcacatgatcatagcttc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11033831 |
agcttcattcgtcattagccggcttgtcacttataaggttcaatt-atatcactgttaccatttatttctttctctctagc----------------ttc |
11033913 |
T |
|
| Q |
335 |
acatgatcattgatcatggcagatgatgatggtgaccatcctttttataag |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11033914 |
acatgatcattgatcatggcagatgatgatggtgaccatcctttttataag |
11033964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University