View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8245_low_5 (Length: 401)

Name: NF8245_low_5
Description: NF8245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8245_low_5
NF8245_low_5
[»] chr5 (1 HSPs)
chr5 (135-385)||(11033731-11033964)


Alignment Details
Target: chr5 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 135 - 385
Target Start/End: Original strand, 11033731 - 11033964
Alignment:
135 ggtatgtttatcaattgtaattaattaatcaaccagtaaccacatttttgtttccattgtgatcaaaccaagaaaacgggtcataaactttgataatgaa 234  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11033731 ggtatgtttatcaattgtaattaattaatgaaccagtaaccacatttttgtttccattgtgatcaaaccaagaaaacgggtcataaactttgataatgaa 11033830  T
235 agcttcattcgtcattagccggcttgtcacttataaggttcaattaacatcactgttaccatttatttctttctctctagcttcacatgatcatagcttc 334  Q
    ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||                |||    
11033831 agcttcattcgtcattagccggcttgtcacttataaggttcaatt-atatcactgttaccatttatttctttctctctagc----------------ttc 11033913  T
335 acatgatcattgatcatggcagatgatgatggtgaccatcctttttataag 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
11033914 acatgatcattgatcatggcagatgatgatggtgaccatcctttttataag 11033964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University