View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8246_high_36 (Length: 202)
Name: NF8246_high_36
Description: NF8246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8246_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 183
Target Start/End: Original strand, 18252748 - 18252913
Alignment:
| Q |
18 |
ggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18252748 |
ggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatca |
18252847 |
T |
|
| Q |
118 |
aagccgctgttaccactgcaatagacgaacaatttcccggtgtaaacggtcttggaatctccattg |
183 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18252848 |
aagccgctgttaccactgcaatagacgcacaatttcccggtgtaaacggtcttggaatttccattg |
18252913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 18256820 - 18256655
Alignment:
| Q |
18 |
ggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18256820 |
ggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatca |
18256721 |
T |
|
| Q |
118 |
aagccgctgttaccactgcaatagacgaacaatttcccggtgtaaacggtcttggaatctccattg |
183 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18256720 |
aagccgctgttaccactgcaatagacgcacaatttcccggtgtaaacggtcttggaatatccattg |
18256655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 18245644 - 18245801
Alignment:
| Q |
18 |
ggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatca |
117 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
18245644 |
ggccccgccggatattcttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacattatca |
18245743 |
T |
|
| Q |
118 |
aagccgctgttaccactgcaatagacgaacaatttcccggtgtaaacggtcttggaat |
175 |
Q |
| |
|
|||| ||||| ||| ||||| | |||| |||||| | ||| |||||||||||||||| |
|
|
| T |
18245744 |
aagcagctgtgacccctgcattcgacgcgcaatttgctggtttaaacggtcttggaat |
18245801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University