View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8246_high_7 (Length: 457)
Name: NF8246_high_7
Description: NF8246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8246_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 431; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 431; E-Value: 0
Query Start/End: Original strand, 7 - 441
Target Start/End: Complemental strand, 37303192 - 37302758
Alignment:
| Q |
7 |
tttggtgttgaaggtatggagataagtgcacgtttgacgatcgtagacgttgatttgattttccgtagctgcgtagaggaggttgttgtggagggcaagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303192 |
tttggtgttgaaggtatggagataagtgcacgtttgacgatcgtagacgttgatttgattttccgtagctgcgtagaggaggttgttgtggagggcaagc |
37303093 |
T |
|
| Q |
107 |
gatgtgatagggcgggaagagtggggtgtgagagaggtgatgcagtggtaggagacggagaagttgttgaggttttgagaagagagtttttggagagatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303092 |
gatgtgatagggcgggaagagtggggtgtgagagaggtgatgcagtggtaggagacggagaagttgttgaggttttgagaagagagtttttggagagatg |
37302993 |
T |
|
| Q |
207 |
gaactgatggaagtgtttgtattgagtagttgctataaagagttgaggtgctgtcgtcggaggttagggttgaagaagaagaagtgcttgagtctgatgc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302992 |
gaactgatggaagtgtttgtattgagtagttgctataaagagttgaggtgctgtcgtcggaggttagggttgaagaagaagaagtgcttgagtctgatgc |
37302893 |
T |
|
| Q |
307 |
atgttgttgtttcttggatggatgcagtgagatggttgagttgtgggtggccgtggcgcagttgttggtggaggagcatgtgtctaacaaccaccgtaac |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37302892 |
atgttgttgtttcttggatggatgcagtgagatggttgagttgtgggtggccgtggcgcagttgttggcggaggagcatgtgtctaacaaccaccgtaac |
37302793 |
T |
|
| Q |
407 |
ctcatgataaattagttgatagatagagatagttt |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302792 |
ctcatgataaattagttgatagatagagatagttt |
37302758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University