View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8246_low_24 (Length: 304)
Name: NF8246_low_24
Description: NF8246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8246_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 36509303 - 36509580
Alignment:
| Q |
19 |
taatctccctctttcacggcacacccgccgcaatcttcggcgccatctccatcttctccgaccccaacagcggcttcgcatccctcaacaccgctttcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36509303 |
taatctccctctttcacggcacacccgccgcaatcttcggcgccatctccatcttctccgaccccaacagcggcttcgcatccctcaacaccgctttcca |
36509402 |
T |
 |
| Q |
119 |
gaaaaccgttcttgattacagcatcgcttacttcgtaaccgatctattacactacgtcgttttcttcccaagcgacgttctcttcatcgctcatcattta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36509403 |
gaaaaccgttcttgattacagcatcgcttacttcgtaaccgatctattacactacgtcgttttcttcccaagcgacgttctcttcatcgctcatcattta |
36509502 |
T |
 |
| Q |
219 |
gccacgcttttcgttatcgtcacgtgccgtcacgtcgtttctcatggctctttctccgtcgtcgttttgcttcttctc |
296 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36509503 |
gccacgcttttcgttatcgtcacgtgtcgtcacgtcgtttctcatggctctttctccgtcgtcgttttgcttgttctc |
36509580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University